Table 1 from Linear-After-The-Exponential (LATE)-PCR: primer design criteria for high yields of specific single-stranded DNA and improved real-time detection. | Semantic Scholar
Table of primers used in this study. | Download Table
View Image
Sequences of primers used for qRT-PCR | Download Table
Table 1 from Guelph Guelph , ON , Canada Single-Primer Amplification of Flanking Sequences | Semantic Scholar
Primer sequences table. | Download Table
Table of primers a Primer name Base position b Sequence 533 | Download Table
View Image
xmlinkhub
Table SI. Primer sequences for PCR. Target gene Primer target Sequence (5'→3') APC Exon 2F CTCTTAGATGCTGCTACTTGA Exon 2R GGAT
PCR primers used in this paper | Download Table
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies | PLOS ONE
Partially Overlapping Primer-Based PCR for Genome Walking | PLOS ONE
Details of PCR primer combinations | Download Table